Journal: Oncology Letters

Article Title: BLID is a drug-responsive target of FOXO3a and multi-omics analysis reveals survival mechanisms and therapeutic vulnerabilities in BLID-deficient breast cancer cells

doi: 10.3892/ol.2025.15155

Figure Lengend Snippet: RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding Scr shRNA group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.

Article Snippet: In addition, Stealth siRNA negative control (scramble) with the same supplier's proprietary sequence designed to minimize sequence homology to any known vertebrate transcript (cat. no. 12935300, Thermo Fisher Scientific, Inc; Invitrogen) was used.

Techniques: Quantitative RT-PCR, Biomarker Discovery, Expressing, Knockdown, Control, shRNA, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: Frontiers in Oncology

Article Title: Bioinformatics and experimental unveiling of TIMP1 as a novel therapeutic target in colorectal cancer ferroptosis

doi: 10.3389/fonc.2025.1593107

Figure Lengend Snippet: TIMP1 promotes the proliferation and migration of CRC cells by inhibiting ferroptosis. (A) WB detected the effect of different transfection concentrations of TIMP1 on the protein expression of GPX4. RSL3 is a specific inhibitor of GPX4, which is used here as a positive control. (B) Clonal formation of two CRC cells after transfection of 100 nM TIMP1 siRNA in HCT-116 cells and SW480 cells. (C) Flow cytometry was used to detect cell death in two CRC lines after transfection of 100 nM TIMP1 siRNA. (D) WB was used to detect the protein expression of TIMP1 after TIMP1 was knocked down or re-adding recombinant TIMP1 protein. (E) WB was used to detect the expression of ferroptosis-related proteins GPX4 and SLC7A11 after knockdown of TIMP1 and re-addition of recombinant TIMP1 protein. (F) The transwell assay was used to detect the migration ability of CRC cells after knockdown of TIMP1 or re-addition of TIMP1 purified protein. Scale bar: 200 μm. The results of (A-F) were from three independent experiments. (G) Representative photograph of CRC xenograft tumors following stable TIMP1 knockdown, accompanied by corresponding statistical graphs depicting tumor weight and growth curves (n = 6). *P<0.05, **P<0.01, ***P<0.001 .

Article Snippet: Commercially synthesized siRNA targeting TIMP1 (siTIMP1) (sense: 5′→3′ UCAUAACGCUGGUAUAAGGUG; antisense: 5′→3′ CCUUAUACCAGCGUUAUGAGA) and scrambled negative control siRNA (siControl) were procured from Shanghai GenePharma Co., Ltd. (Shanghai, China).

Techniques: Migration, Transfection, Expressing, Positive Control, Flow Cytometry, Recombinant, Knockdown, Transwell Assay, Purification

Journal: Science Advances

Article Title: External strain on the plasma membrane is relayed to the endoplasmic reticulum by membrane contact sites and alters cellular energetics

doi: 10.1126/sciadv.ads6132

Figure Lengend Snippet: ( A ) RT-qPCR analysis of PM-ER tether proteins in mouse tendon cells (three biological replicates from three independent experiments). ( B ) Schematic diagram illustrating the experimental approach used to test membrane tension of tendon cells transfected with scrambled siRNA or Stim1 -siRNA. ( C and D ) Immunoblot analysis (C) and quantification (D) of STIM1 expression in cells 3 days post-siRNA transfection (three biological replicates from three independent experiments). ( E and F ) Representative FLIM images (E) of ER Flipper-TR in cells transfected with siRNA (top). Bottom panels show enlarged views of ER tubules (purple dashed rectangles) and ER sheets (white dashed rectangles) from the top panels, alongside confocal images displaying intensity, and quantification (F) selecting the overall ER, ER tubules, or ER sheets ( n = 25 to 30), as the ROI. ( G and H ) Representative FLIM images (G) of Flipper-TR in cells transfected with siRNA and quantification (H) selecting the PM as the ROI ( n = 30). ( I ) Schematic illustrating 2D mechanical stimulation to tendon cells transfected with siRNA. ( J and K ) Representative FLIM images of ER Flipper-TR in cells transfected with siRNA after 2D 6% cyclic strain (J) and quantification (K) ( n = 30). ( L and M ) Representative FLIM images of ER Flipper-TR in tendon cells transfected with siRNA after 2D 0, 3, or 9% cyclic strain (L) and quantification (M) ( n = 21 to 24). ( N ) Interaction plot from two-way ANOVA indicating the interactive effect of partial Stim1 knockdown and cyclic strain on ER tension. ( O ) Schematic illustrating that detethering the ER from the PM disrupts mechanical force propagation, reducing adaptive ER tension. Scale bars, 1 μm. n , cells per group, each with at least two ROIs, from three independent experiments. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s., not significant by Student’s t test (D, F, H, and K) or two-way ANOVA with Sidak’s post hoc (M and N). Error bars stand for SEM. (B), (I), and (O) created with BioRender.com .

Article Snippet: Tendon cells were transfected with Stim1 siRNA (s13563, Thermo Fisher Scientific) and negative control scrambled siRNA (4390843, Thermo Fisher Scientific) at 10 nM unless stated otherwise, using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) for a 6-hour incubation according to the manufacturer’s protocol.

Techniques: Quantitative RT-PCR, Membrane, Transfection, Western Blot, Expressing, Knockdown

Journal: Science Advances

Article Title: External strain on the plasma membrane is relayed to the endoplasmic reticulum by membrane contact sites and alters cellular energetics

doi: 10.1126/sciadv.ads6132

Figure Lengend Snippet: ( A ) Representative confocal images and analysis of CFSE-labeled cells (green), phalloidin-labeled F-actin (red), and merged images with Hoechst-labeled nuclei (blue) in tendon cells transfected with either scrambled siRNA or Stim1 -siRNA or treated with cytochalasin D. For image analysis, the cell contour (yellow) is indicated by CFSE, and the F-actin orientation is color coded (rightmost images). More highly magnified images in the phalloidin-stained cells (middle) and the color-coded F-actin orientation indicated that cells (rightmost) are of the white dashed boxed areas. Scale bars, 10 μm. ( B ) Fluorescence intensity quantification by analyzing phalloidin fluorescence intensity divided by cell area ( n = 15 cells per group from three independent experiments). ( C ) Dispersion quantification of F-actin by analyzing F-actin orientation ( n = 15 cells per group from three independent experiments). ( D ) Representative FLIM images of PM tension probe Flipper-TR–stained tendon cells treated with carrier [dimethyl sulfoxide (DMSO)] or with cytochalasin D. Scale bar, 1 μm. ( E ) Distribution of the fluorescence lifetime of Flipper-TR selecting the PM as the ROI in tendon cell treated with or without cytochalasin D ( n = 25 cells per group, each with at least two ROIs, from three independent experiments). ** P < 0.01; *** P < 0.001; n.s., not significant by Student’s t test (B and C) or by one-way ANOVA (E). Error bars stand for SEM.

Article Snippet: Tendon cells were transfected with Stim1 siRNA (s13563, Thermo Fisher Scientific) and negative control scrambled siRNA (4390843, Thermo Fisher Scientific) at 10 nM unless stated otherwise, using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) for a 6-hour incubation according to the manufacturer’s protocol.

Techniques: Labeling, Transfection, Staining, Fluorescence, Dispersion

Journal: Science Advances

Article Title: External strain on the plasma membrane is relayed to the endoplasmic reticulum by membrane contact sites and alters cellular energetics

doi: 10.1126/sciadv.ads6132

Figure Lengend Snippet: ( A ) Representative time course of cytosolic Ca 2+ measurements in Fluo-4 NW–loaded tendon cells transfected with scrambled siRNA or Stim1 -siRNA and further treated with DMSO (carrier) or Synta66 for 6 days. ( B ) Normalized maximal values of SOCE from tendon cells transfected with siRNA and further treated with DMSO or Synta66 for 6 days (five biological replicates, three independent experiments). ( C ) Cartoon showing the PM-ER contact sites measured by SPLICS L ER-PM that can detect interactions occurring between the PM and the ER within a reciprocal distance of around 40 nm. ( D ) Representative 3D-rendered confocal image of tendon cells expressing SPLICS L ER-PM . SPLICS L ER-PM spots were rendered by detecting SPLICS L ER-PM signals. Rendered intracellular view (bottom) is an enlargement of the red dashed boxed area in the top panel, showing SPLICS L ER-PM spot-labeled PM-ER contact sites. ( E and F ) Representative 3D-rendered confocal images of tendon cells expressing SPLICS L ER-PM and transfected with siRNA, further treated with DMSO or Synta66 for 6 days (E) and quantification (F) ( n = 31 to 37 cells per group from three independent experiments). Each top left panel is an enlargement of the yellow dashed boxed area in the corresponding middle panel. Scale bars, 10 μm. ( G ) Schematics summarizing the status of PM-ER tethering and the SOCE ability in tendon cells with different treatments. ( H and I ) Representative FLIM images (H) of ER Flipper-TR in tendon cells transfected with siRNA and treated with DMSO or Synta66 in 2D cyclic stretching environment for 6 days and quantification (I) ( n = 24 cells per group, each with at least two ROIs, from three independent experiments). Scale bars, 1 μm. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s., not significant by one-way ANOVA (B and I) or Kruskal-Wallis test (F). Error bars stand for SEM. (C) and (G) created with BioRender.com .

Article Snippet: Tendon cells were transfected with Stim1 siRNA (s13563, Thermo Fisher Scientific) and negative control scrambled siRNA (4390843, Thermo Fisher Scientific) at 10 nM unless stated otherwise, using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) for a 6-hour incubation according to the manufacturer’s protocol.

Techniques: Transfection, Expressing, Labeling

Journal: Science Advances

Article Title: External strain on the plasma membrane is relayed to the endoplasmic reticulum by membrane contact sites and alters cellular energetics

doi: 10.1126/sciadv.ads6132

Figure Lengend Snippet: ( A and B ) Representative TEM images of 3D tendon constructs transfected with siRNA and cultured under 9% cyclic strain showing PM-ER contacts (A). Middle panels highlighting the PM (red), ER (orange), and contact sites (yellow). PM-ER contact sites, a reciprocal distance of 30 nm. Right panels are from the purple dashed boxed area in the middle panel. ExcM, extracellular matrix. (B) Quantification to the extent of individual PM-ER contact site ( n = 62 to 73 contact sites). ( C and D ) Representative confocal images of GFP-labeled ER (C) and ER morphology analysis (D) in constructs ( n = 15 cells). ( E and F ) Representative 3D confocal images (E) showing colocalization of RFP-labeled mitochondria and GFP-labeled ER in constructs transfected with siRNA under 9% strain and Manders’ coefficient quantification (F) ( n = 15 cells). ( G and H ) Representative SIM imaging (G) and distribution maps of GFP-labeled ER on RFP-labeled mitochondria (H) in constructs receiving 9% strain and transfected with siRNA. ( I and J ) Representative TEM images of constructs transfected with siRNA under 9% strain showing the ER-mitochondria contacts (I) and quantification (J) ( n = 67 to 107 contact sites). ( K to M ) ATP luminescence (K), representative confocal fluorescence images of H 2 DCFDA-labeled ROS (L), and H 2 DCFDA quantification (M) ( n = 5 biological replicates) in constructs receiving 9% strain with siRNA transfection. ( N ) Mitochondrial respiration of tendon constructs transfected with siRNA and treated with DMSO or Synta66 under 9% strain ( n = 7 biological replicates). ( O ) Luminescence measurement of ATP in constructs receiving 9% strain, transfected with siRNA, and treated with DMSO or Synta66 ( n = 5 biological replicates). Scale bars, 200 nm (A and I), 10 μm (C and L), or 1 μm (E and G). n , replicates per group from at least three independent experiments. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s., not significant by Student’s t test (B, D, F, K, M, and J) or one-way ANOVA (N and O). Error bars stand for SEM.

Article Snippet: Tendon cells were transfected with Stim1 siRNA (s13563, Thermo Fisher Scientific) and negative control scrambled siRNA (4390843, Thermo Fisher Scientific) at 10 nM unless stated otherwise, using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) for a 6-hour incubation according to the manufacturer’s protocol.

Techniques: Construct, Transfection, Cell Culture, Labeling, Imaging, Fluorescence